Сравнительное изучение эффективности Agrobacterium опосредованно

На правах рукописи

Вячеславова Алиса Олеговна

СРАВНИТЕЛЬНОЕ ИЗУЧЕНИЕ ЭФФЕКТИВНОСТИ AGROBACTERIUM-ОПОСРЕДОВАННОЙ ТРАНЗИЕНТНОЙ ЭКСПРЕССИИ ГЕТЕРОЛОГИЧНЫХ ГЕНОВ, КОДИРУЮЩИХ РЕКОМБИНАНТНЫЕ БЕЛКИ

Специальность 03.01.06 – биотехнология (в том числе бионанотехнологии)

Автореферат

диссертации на соискание ученой степени

кандидата биологических наук

Москва 2012

Работа выполнена в Федеральном государственном бюджетном учреждении науки Институте общей генетики им. Н.И. Вавилова Российской академии наук

Научный руководитель:

доктор биологических наук, доцент Голденкова-Павлова Ирина Васильевна

Официальные оппоненты:

Дейнеко Елена Викторовна доктор биологических наук, профессор, Институт цитологии и генетики Сибирского отделения Российской академии наук, лаборатория биоинженерии растений, заведующая лабораторией

Демин Илья Николаевич кандидат биологических наук, Институт физиологии растений имени К.А. Тимирязева Российской академии наук, лаборатория зимостойкости, научный сотрудник

Ведущая организация:

Филиал института биоорганической химии им. академиков М.М. Шемякина и Ю.А. Овчинникова Российской академии наук

Защита состоится « 14 » ноября 2012 года в 16-30 на заседании диссертационного совета Д220.043.10 при Российском государственном аграрном университете – МСХА имени К.А. Тимирязева по адресу: 127550, г. Москва, ул. Тимирязевская, 49, тел./факс: (499) 976-24-92, e-mail: [email protected]

Автореферат разослан « 12 » октября 2012 г.

Ученый секретарь диссертационного советаЛ.С. Большакова

Общая характеристика работы

Актуальность проблемы. В настоящее время трансгенные растения широко используются как модели для изучения фундаментальных исследований по изучению физиологической роли растительных генов и для решения прикладных задач по созданию устойчивых форм сельскохозяйственных культур, а также для продукции рекомбинантных белков в растениях. Успех в этих направлениях, прежде всего, связан с эффективностью экспрессии перенесенного гена (трансгена) в растениях. Эффективность экспрессии трансгена обуславливается рядом факторов: кодоновым составом трансгена; регуляторными элементами, контролирующими его экспрессию; интеграцией трансгена в определенные участки генома растений и рядом других. Сейчас, помимо стабильной экспрессии целевых генов исследователями широко используется транзиентная экспрессия этих генов как эффективный подход для изучения регуляторных элементов и физиологической роли генов растений, а также для использования растений как продуцентов целевых белков. При транзиентной экспрессии с использованием агробактерий, в основном, используют обычные экспрессионные векторы, полученные на основе бинарных Ti-плазмид, которые, помимо целевого гена содержат и селективные гены. Для преодоления эффекта «замолкания» трансгена исследователи используют подход, основанный на ко-трансформации растений вектором, несущий ген белка р19 вируса томатов, супрессор посттранскрипционного замолкания генов. Несмотря на значительные успехи в области создания и изучения трансгенных растений, наши познания в отношении генетических факторов, которые оказывают влияние на эффективность экспрессии генов в растениях, еще весьма ограничены. Следует подчеркнуть, что решение важных научных и прикладных задач с использованием экспрессии гетерологичных генов в растениях затруднено, прежде всего, за счет значительных пробелов в понимании генетических детерминант, которые обуславливают эффективную экспрессию гетерологичных генов в растениях. Следует также отметить, что важную роль в исследованиях по созданию и изучению трансгенных растений играют экспрессионные вектора, используемые для трансформации растений. Сейчас предложены и используются целый спектр экспрессионных векторов для трансформации растений, однако, наряду с преимущества эти вектора имеют и недостатки, которые могут сказаться на эффективности экспрессии трансгена.

Цель исследования: провести сравнительное изучение экспрессии гетерологичных генов в растениях различных родов и выяснить, какие генетические детерминанты являются ключевыми в обеспечении эффективности экспрессии гетерологичных генов в растениях.

Исходя из цели работы, были поставлены следующие задачи:

Провести поиск генетических детерминант, которые потенциально способны влиять на уровень экспрессии гетерологичных генов с использованием биоинформатических подходов.

Провести модификацию нуклеотидных последовательностей модельных генов и клонирование новых регуляторных элементов.

Сконструировать серию модульных экспрессионных векторов дл изучения экспрессии гетерологичных генов в растениях.

Провести апробацию модульных векторов, в которых экспрессия модельных генов с различным кодоновым составом контролируется различными регуляторными элементами.

Научная новизна работы. Проведен сравнительный анализ генетических детерминант, которые потенциально способны влиять на уровень экспрессии гетерологичных генов в растениях. Впервые экспериментально показано, что GC-богатые последовательности в 5’-концевой области генов вносят значительный вклад в уровень экспрессии гетерологичных генов в растениях. Показана возможность достоверного увеличения экспрессии гетерологичных генов за счет использования лидерных сигналов транспорта и локализации их белковых продуктов в эндоплазматическом ретикулуме. Показана взаимосвязь между кодоновым составом гетерологичных генов и уровнем их экспрессии в растительных клетках.

Апробация результатов работы. Результаты проведенных исследований были представлены на международных и российских конференциях: Международная научная конференция «Генетика и биотехнология на рубеже тысячелетий» (Минск, 2010), III Всероссийский симпозиум «Физиология трансгенного растения и проблемы биобезопасности» (Москва, 2010), 2-я Международная школа-конференция молодых ученых «Генетика и селекция растений, основанная на современных генетических знаниях и технологиях» (Звенигород, 2011), International conference «Plant Transformation Technologies II» (Vienna, 2011); конференция «Современные аспекты генетической инженерии растений» (Киев, 2011); 12-я научная конференция молодых ученых «Биотехнология в растениеводстве, животноводстве и ветеринарии» (Москва, 2012); Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы» (Минск, 2012).

Структура и объем диссертации. Диссертационная работа состоит из введения, обзора литературы, материалов и методов исследования, результатов и обсуждения, а также выводов и списка цитируемой литературы. Работа изложена на 159 страницах машинописного текста, включая 12 таблиц и 60 рисунков. Список цитируемых литературных источников включает 269 наименований.

Основное содержание работы

Глава 1. Обзор литературы. В обзоре литературы приведены современные данные о подходах к экспрессии гетерологичных генов в растениях, а также проведен анализ особенностей растительных экспрессионных векторов. Особое внимание уделено исследованию генетических детерминант, обуславливающих высокую экспрессию перенесенного гена (трансгена) на разных уровнях: транскрипция, трансляция, стабильность белка.

Глава 2. Материалы и методы. В работе использованы стандартные процедуры молекулярного клонирования, которые выполнялись согласно методическому руководству Sambrook et al. (2001). В работе использовали растения табака Nicotiana benthamiana и Nicotiana excelsior, выращенные до 6 недельного возраста.

В работе использованы штамм E. coli XL1-Blue (“Stratagene”, США) и штамм агробактерий GV3101. Клетки E. coli выращивали при 370C, а клетки агробактерий — при 280C на среде LB. Процедура агроинфильтрации проводилась по методу инъекции агробактериальной смеси с помощью шприца в листовую пластину.

Анализ полученных растений после агроинфильтрации проводили на четвертые сутки путем выделения суммарного растворимого белка из листьев путем растирания свежей или замороженной растительной ткани в жидком азоте в 50 мМ Tris-HСl (pН=8.0) буфере.

Активность лихеназы определяли, используя лихенан (Megazyme, Ирландия) в качестве субстрата. Определение восстанавливающих сахаров, освобождающихся из субстрата, проводили по методу Вуда и Бхат [Wood T.M. et al., 1988].

Концентрацию восстанавливающих сахаров определяли по калибровочному графику, построенному по глюкозе. За единицу активности принимали количество фермента, образующее 1 мкмоль восстанавливающих сахаров (как эквивалент глюкозы) за 1 мин (в пересчете на 1 мг белка).

Количество белка в препаратах определяли по методу Bradford [Bradford, M. A., 1976], используя Bio-Rad dye reagent (BioRad, США) и БСА (Sigma, США) для построения калибровочной кривой.

Энзимограммы получали окрашиванием геля после разделения белков, содержащего лихенан согласно методу Тизер и Вуд [Teather R. et al., 1982], с некоторыми модификациями. Определение активности лихеназы на чашках проводили по методу Бегуин [Begiun P., 1983].

Статистическая обработка результатов проводилась с использованием программы «Statistica for Windows 9.0» (применяли t-критерий Стьюдента для независимых выборок, Р=0,05) и графопостроителя «Microsoft Office Excel 2007».

Глава 3. Результаты и обсуждения.

3.1 Поиск генетических детерминант, позитивно влияющих на уровень транскрипции, трансляции и стабильности целевых белков в растениях

Ключевым регуляторным элементом, от которого зависит уровень транскрипции, является промотор, который, как правило, расположен в 5’-концевой области генов. Для поиска промоторов растений, которые могут позитивно сказаться на экспрессии гетерологичного гена, был проведен поиск с использованием базы данных FlowerPlantGene и сопровождающего программного обеспечения. Для этого проведен сравнительный анализ данных по уровню экспрессии генов Arabidopsis и данные о генах этого растения. Проведенный анализ позволил установить, что наивысший уровень экспрессии выявлен для гена AT1G67090, кодирующего малую субъединицу рибулозо-бисфосфат карбоксилазы. Следует отметить, что ген AT1G67090 относится к генам «домашнего хозяйства», которые обычно характеризуются высоким уровнем экспрессии. На основании этого, промотор гена AT1G67090, имеющий наивысший уровень экспрессии в растении в целом, и в листьях, в частности, может быть использован как регуляторный элемент, позитивно влияющий на уровень транскрипции гетерологичных генов в растениях.

В качестве потенциальных промоторов, обеспечивающих высокий уровень экспрессии, могут быть использованы и промоторы вирусов. Один из таких промоторов – 35S РНК CaMV (промотор 35S РНК вируса мозаики цветной капусты) — широко используется как промотор для высокоэффективной экспрессии гетерологичных генов в растениях.

Другими регуляторными последовательностями, которые могут позитивно повлиять на уровень транскрипции генов в растениях, являются GC-богатые последовательности. Известно, что в геномах млекопитающих имеются протяженные последовательности, обогащенные GC-парами, которые обозначают как CpG-островки. CpG-островки представляют собой GC-богатые последовательности (60-70% содержания GC), длиной не менее 200 п.о. с большим числом динуклеотидов CpG. CpG-богатые области, которые ассоциированы с 5’-концевой областью генов, в частности, генов «домашнего хозяйства», описаны и у растений ADDIN EN.CITE Meza200218418417Meza, T. J.Enerly, E.Boru, B.Larsen, F.Mandal, A.Aalen, R. B.Jakobsen, K. S.Department of Biology, University of Oslo, Norway.A human CpG island randomly inserted into a plant genome is protected from methylationTransgenic Res Transgenic Res133-42112Arabidopsis/*geneticsChromatinCpG Islands/*genetics*DNA MethylationDNA, BacterialGene DosageGene SilencingHumansPlants, Genetically ModifiedResearch Support, Non-U.S. Gov't2002Apr12054347http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Citation&list_uids=12054347 [Meza et al., 2002]. Для выяснения частоты встречаемости CpG-богатых областей в геноме растений был проведен биоинформационный поиск с использованием данных и программного обеспечения базы данных FlowerPlantGene. База данных FlowerPlantGene содержит информацию о полноразмерных геномах растений (Arabidopsis и кукуруза) и программное обеспечение для поиска и отображения локализации произвольных последовательностей на хромосоме и в блоках произвольной длины.

Как было показано по результатам анализа, в геноме Arabidopsis thaliana GC-богатые последовательности не представлены, по сравнению с геномом кукурузы. Среднее содержание GC-пар в геноме арабидопсиса составляет в среднем 24,3%, а в геноме кукурузы – в среднем 39%.

Ключевую роль в эффективности трансляции оказывает окружение AUG кодона – инициирующего кодона трансляции. Предполагается, что оптимальный контекст для инициации трансляции у животных и растений – AACAATUGC. Такая консенсусная последовательность (последовательность Козак [Kozak, 1986]), играющая важную роль в инициации трансляции у эукариот, включает 4-6 нуклеотидов, предшествующих старт-кодону, и 1-2 нуклеотида непосредственно после старт-кодона. Особую роль в данной последовательности играют нуклеотиды в положениях -3 и +4. Следует подчеркнуть, что для выяснения роли нуклеотидов в – 3 и +4 положениях из окружения инициирующего кодона в обеспечении высокого уровня экспрессии необходим сравнительный анализ данных частоты встречаемости нуклеотидов в этих положениях и уровня экспрессии генов растений.

С использованием программного обеспечения базы данных FlowerPlantGene для совокупности генов с различным уровнем экспрессии рассчитана частота каждого нуклеотида (A, T, G или C) в положении – 3 и +4 из окружения инициирующего кодона.

Для анализа взаимосвязи между нуклеотидами в –3 и +4 положениях из окружения инициирующего кодона и уровнем экспрессии, были сформированы три группы генов с уровнем относительной экспрессии. Согласно такому разделению 88,7%, 8,2 и 3,1% генов арабидопсиса имеют уровни экспрессии от 0 до 50, от 51 до 100 и от 101 и выше, соответственно. Проведенный анализ позволил выявить следующие закономерности: у 68,4% и 67,6% генов с уровнем относительной экспрессии от 51 до 100 и от 101 и выше, соответственно, в положении – 3 встречается нуклеотид А, а в положении +4 – нуклеотид G (с частотой от 0,6 и до 0,9); у 1,4% генов с уровнем относительной экспрессии от 0 до 51 в положении –3 встречается нуклеотид А, а в положении +4 – нуклеотид G (с частотой от 0,6 и до 0,9).

Последующий анализ генов растений с использованием программного обеспечения базы данных FlowerPlantGene позволил выяснить, что нуклеотид G в положении +4 встречается у более 50% генов разных видов растений.

Одним из основных правил жизни белкового продукта является правило «N-конца» (N-end rule), которое гласит: время полу-жизни белка определяется конкретным N-концевым аминокислотным остатком его полипептидной цепи [Bachmair et al., 1986; Varshavsky, 1996; Hu et al., 2005; Tasaki and Kwon, 2007]. Таким образом, были выделены дестабилизирующие а.о., определяющие время жизни белка. Интересно, что у дестабилизирующих аминокислотных остатков (а.о.) есть своя иерархия: некоторые а.о., названные первичными дестабилизирующими а.о., непосредственно узнаются убиквитин-лигазами, другие (вторичные и третичные) — требуют дополнительной модификаций перед узнаванием системой убиквитинирования [Worley et al., 1998]. К третичным дестабилизирующим а.о. относятся глутамин (Gln), аспарагин (Asn) и цистеин (Cys), к вторичным — глутаминовая (Glu) и аспарагиновая (Asp) кислоты; а к первичным – аргинин (Arg), лизин (Lys), гистидин (His), лейцин (Leu), изолейцин (Ile), фенилаланин (Phe), триптофан (Trp), тирозин (Tyr) и пролин (Pro). К стабилизирующим аминокислотным остаткам относятся метионин (Met), глицин (Gly), валин (Val), треонин (Thr), серин (Ser) и аналин (Ala) [Worley et al., 1998]. Анализ генов растений с использованием программного обеспечения базы данных FlowerPlantGene позволил выяснить некоторые закономерности распределения вторых кодонов в кодирующих областях генов растений разных видов. Для анализа были выбраны только кодоны, первый нуклеотид которых начинается с нуклеотида G. Среди вторых кодонов, первый нуклеотид которых начинается G, для генов арабидобсиса, кукурузы и риса к стабилизирующим аминокислотным остаткам принадлежат 35,2%, 39,8% и 44,9%, соответственно. При этом, отмечена высокая частота встречаемости второго кодона аланина у генов разных видов растений.

Таким образом, проведенный поиск нуклеотидных последовательностей, которые могут позитивно влиять на уровень транскрипции, трансляции и стабильности целевых белков в растениях с использованием биоинформационного анализа созданной базы данных и анализа литературы позволяет сделать следующие заключения: 5’-область гена AT1G67090, имеющего наивысший уровень экспрессии в растении в целом, и в листьях, в частности, может быть использована как регуляторный элемент, позитивно влияющий на уровень транскрипции гетерологичных генов в растениях; промоторы вирусов могут быть тестированы в качестве потенциальных регуляторных элементов, способных в значительной степени увеличить уровень транскрипции целевых генов в растениях; GC-богатые области, ассоциированные с генами растений, характеризующимися высоким уровнем экспрессии, могут быть потенциальными регуляторными элементами, позитивно влияющими на уровень транскрипции гетерологичных генов в растениях; нуклеотид А в –3 и нуклеотид G в +4 положениях из окружения инициирующего кодона могут играть ключевую роль в увеличении эффективности трансляции генов растений; свойства второго кодона в последовательности белка могут в значительной степени повлиять на стабильность белкового продукта в растениях.

3.2. Создание модульных векторов для апробации регуляторных элементов c использованием бирепортерных генов

3.2.1. Конструирование бифункциональных репортерных генов licB::rfp и egfp::licB и их апробация в бактериальных клетках

В качестве репортерных генов нами предложены бирепортерные гены, имеющие транскрипционно-трансляционное слияние гена, кодирующего термостабильную лихеназу с геном, кодирующим красный флуоресцентный белок (licB::rfp), и с геном зеленого флуоресцентного белка (egfp::licB). Для создания бирепортерных генов первоначально была проведена ПЦР. В качестве матрицы для создания плазмид, несущих бирепортерные гены, были использованы плазмиды pQE30-LicBM3 (из коллекции лаборатории), pQE30-EGFP (из коллекции лаборатории) и Gateway® TagRFP-AS-C (ЗАО «Евроген», Россия), а также специально подобранные олигонуклеотидные последовательности. Методами молекулярного клонирования были полученные бактериальные вектора pQE30-EGFP-LicBM3 и pQE30-LicBM3-RFP, которые затем были апробированы в бактериальных клетках на функциональность всех репортерных генов. Корректность сборки бактериальных векторов была подтверждена рестрикционным анализом.

Первоначально, бактериальные трансформанты, несущие плазмидные вектора, были проанализированы методом чашечного теста для того чтобы показать, что лихеназа в составе гибридных белков сохраняет свои основные свойства (рис. 1).

Рисунок 1. Чашечный тест бактериальных трансформантов: pQE30-LicBM3-RFP, pQE30-EGFP-LicBM3, pQE30-RFP, pQE30-EGFP, K+ — положительный контроль (pQE30-LicBM3), K- — отрицательный контроль (pQE30).

Для того чтобы показать, что красный флуоресцентный белок в составе гибридного белка сохраняет свои основные свойства, бактериальные трансформанты, несущие плазмидный вектор pQE-LicBM3-RFP, были проанализированы методом флуоресцентной микроскопии (рис. 2).

Рисунок 2. Флуоресцентная микроскопия бактериальных трансформантов: pQE30-LicBM3-RFP – сконструированный плазмидный вектор; K+ — положительный контроль (pQE30-RFP); K- — отрицательный контроль (pQE30-LicBM3).

Для того чтобы показать, что зеленый флуоресцентный белок в составе гибридного белка сохраняет свои основные свойства, бактериальные трансформанты, несущие плазмидный вектор pQE-EGFP-LicBM3, были проанализированы методом чашечного теста (данные в автореферате не приводятся).

Таким образом, полученные данные свидетельствуют о том, что в составе гибридных белков сохраняют свои основные свойства как лихеназа, так и красный флуоресцентный белок и зеленый флуоресцентный белок – активность, термостабильность и способность к флуоресценции, соответственно.

Для того, чтобы доказать, что в клетках прокариот происходит образование гибридных белков, белковые бесклеточные лизаты были проанализированы методом энзимограмм (рис. 3).

Рисунок 3. Энзимограмма белковых бесклеточных лизатов: RL – pQE30-EGFP-LicBM3, LR – pQE30-LicBM3-RFP, K – pQE30-LicBM3, M – маркер белкового веса (kDa).

Как видно из представленных данных (рис. 3), в клетках бактерий образуются гибридные белки, молекулярная масса которых соответствует теоретически рассчитанной – около 52 кДа. (LicBM3 – 25 кДа, RFP – 27 кДа, EGFP – 27 кДа).

3.2.2 Описание и создание модульных векторов серии pPGG и pVIG-S

Первоначально, на основе данные анализа литературных источников, а также с учетом недостатков экспрессионных векторов, которые предложены и используются в настоящее время, нами разработаны и сконструированы две серии модульных экспрессионных векторов.

В первой серии векторов, обозначенной нами как pPGG, предлагается учесть большинство факторов, способных обеспечить эффективную экспрессию гетерологичных генов в растениях, а именно: окружение инициирующего ATG кодона целевого гена; последовательности, кодирующие стабилизирующие аминокислоты во втором положении после инициирующего кодона; локализация и состав кодонов, терминирующих транскрипцию; оптимальный состав области полиаденилирования.

Базовый вектор этой серии имеет небольшой размер и предназначен для клонирования целевых генов и регуляторных элементов, поскольку модульная структура вектора позволят легко проводить замену регуляторных элементов, контролирующих экспрессию гетерологичного гена в растениях, таких как промоторы, последовательности лидерных пептидов, последовательности 3′- и 5′-НТО, важных для эффективной экспрессии трансгена, а также целевых генов (рис. 4).

Рисунок 4. Модульные экспрессионные вектора pPGG (A), pVIG-S (B). R1 – SacI; R2 – SpeI; R3 – SphI; R4 – KpnI; R5 – ApaI; R6, R13 – BamHI; R7 – EcoRI; R8 – SmaI; R9 – XbaI; R10 – HpaI; R11 – XhoI; R12 – SalI; LB и RB – левая и правая граница Т-ДНК области; oriV – точка начала репликации для агробактерий; Ampr – кассета устойчивости к ампицилину; Kanr – кассета устойчивости к канамицину; pUC ori – точка начала репликации для E.coli; 35S – CaMV 35S промотор; polyA – сигнал полиаденирования; Nos – промотор нопалин синтетазы; NOS T – терминирующая последовательность гена нопалин синтетазы.

На основе базового вектора этой серии сконструированы модульные вектора серии pPGG, в которых клонированы последовательности разных бирепортерных генов (gfp::licB, licB::rfp), а также регуляторных элементов, такие как лидерные последовательности экстенсина Lex (обеспечивает вынос белка в апопласт растительной клетки) [Piruzian E.S. et al., 2002.; Э.С.Пирузян и др., 2000; Jouzani G. S., Goldenkova I. V., 2008], малой субъединицы РБФК\О Lch (обеспечивает транспорт белка в хлоропласты) [Э.С.Пирузян и др., 2000] и последовательности, обеспечивающие транспорт белка и его удержание в эндоплазматическом ретикулуме LeB4 и SRKDEL [Alanen H. I. et al., 2011]. Помимо этого, в 5’-НТО была клонирована (GC)n-обогащенная последовательность (рис. 5). Следует подчеркнуть, что между последовательностями репортерных генов включен сайт рестрикции, что дает возможность использовать любой репортерный ген для трансрипкционно-трансляционного слияния с последовательностями целевых генов.

Рисунок 5. Серия модульных векторов на основе вектора pPGG. R1 – SacI; R2 – SpeI; R3 – SphI; R4 – KpnI; R5 – ApaI; R6 – BamHI; R7 – EcoRI; R8 – SmaI; R9 – XbaI; R10 – HpaI; R11 – XhoI; R14 – SalI; R15 – PstI; R16 – HindIII; LicBM3 – ген, кодирующий термостабильную лихеназу Clostridium thermocellum; RFP – ген tagRFP, кодирующий красный флуоресцентный белок; GFP – ген egfp, кодирующий зеленый флуоресцентный белок; LeB4 – лидерный сигнал гена LeB4 (легумина типа B4) гороха Vicia faba; KDEL – последовательность в 3’-концевой области целевого гена, кодирующая аминокислоты С-концевой области белка; lex – лидерный сигнал гена экстенсина моркови; lch – лидерный сигнал, способный направлять продукт целевого гена в хлоропласты; (CG)n — последовательность, обогащенная CG нуклеотидами; 35S – CaMV 35S промотор; polyA – сигнал полиаденирования.

Вторая серия векторов, обозначенная нами pVIG-S (рис. 6), предназначена для клонирования экспрессионных модулей векторов серии pPGG и для изучения стабильной экспрессии гетерологичных генов в растениях. Вектор pVIG-S сконструирован на основе плазмиды pICH6692. Этот вектор имеет размер 6342 п.н. В Т-ДНК область вектора включены следующие последовательности: селективный ген nptII, экспрессия которого контролируется Pnos промотором и nos терминатором; последовательность полилинкера, включающая уникальные сайты с интегрированным между ними случайной последовательности ДНК, для простой процедуры переноса экспрессионного модуля из вектора pPGG. На основе базового вектора pVIG-S были сконструированы вектора для изучения исследуемых регуляторных элементов (рис. 6).

Рисунок 6. Серия модульных векторов на основе вектора pVIG-S для стабильной экспрессии трансгена. R1 – SacI; R2 – SpeI; R4 – KpnI; R5 – ApaI; R6 – BamHI; R7 – EcoRI; R8 – SmaI; R9 – XbaI; R10 – HpaI; R11 – XhoI; R14 – SalI; R15 – PstI; R16 – HindIII; LicBM3 – ген, кодирующий термостабильную лихеназу Clostridium thermocellum; RFP – ген tagRFP, кодирующий красный флуоресцентный белок; GFP – ген egfp, кодирующий зеленый флуоресцентный белок; LeB4 – лидерный сигнал гена LeB4 (легумина типа B4) гороха Vicia faba; KDEL – последовательность в 3’-концевой области целевого гена, кодирующая аминокислоты С-концевой области белка; lex – лидерный сигнал гена экстенсина моркови; lch – лидерный сигнал, способный направлять продукт целевого гена в хлоропласты; (CG)400, (GC)2000 — последовательности, обогащенные CG нуклеотидами разной длины и композиции; 35S – CaMV 35S промотор; polyA – сигнал полиаденирования; LB и RB – левая и правая граница Т-ДНК области; oriV – точка начала репликации для агробактерий; Ampr – кассета устойчивости к ампицилину; Kanr – кассета устойчивости к канамицину; pUC ori – точка начала репликации в E.coli; Nos – промотор нопалин синтетазы; NOS T – терминирующая последовательность гена нопалин синтетазы.

3.3. Апробации модульных векторов с репортерными генами и различными регуляторными элементами

Для того чтобы продемонстрировать обеспечение экспрессии бирепортерных генов в составе сконструированных векторов серии pVIG-S, полученными экспрессионными векторами проведена трансформация агробактериального штамма GV3101 и далее полученными агробактериальными трансформантами была проведена агробактериальная инфильтрация растений табака N. benthamiana.

Эффективность процесса агроинфильтрации оценивали по флуоресценции зеленого флуоресцентного белка, который экспрессируется в составе бирепортерного белка (GFP::LicB) (рис.7).

Рисунок 7. Флуоресценция зеленого флуоресцентного белка в листьях растений табака Nicotiana benthamiana через 4 дня после агроинфильтрации.

Через 4 суток после агроинфильтрации из зараженных частей листьев готовили белковые экстракты. Первоначально белковые экстракты были проанализированы методом чашечного теста на наличие лихеназной активности (рис. 8).

Рисунок 8. Чашечный тест на активность лихеназы в белковых листьях растений табака Nicotiana benthamiana через 4 дня после агроинфильтрации. Ряд А – лунка А1 – белковый лизат бактериального трансформанта, экспрессирующего термостабильную лихеназу (положительный контроль); Ряд Б — белковые лизаты контрольных растений; ряд В – белковые лизаты растений с агроинфильтрацией вектором 35S-Lch-G-L; ряд Г – белковые лизаты растений с агроинфильтрацией вектором 35S-Lex-G-L; ряд Д – белковые лизаты растений с агроинфильтрацией вектором 35S-LeB4-G-L-KDEL; ряд Е – белковые лизаты растений с агроинфильтрацией вектором 35S-S1-G-L и 35S-S2-G-L.

Как видно из результатов, представленных на рисунке 8, активность лихеназы выявлена в белковых лизатах, полученных из листьев растений табака после агроинфильтрации.

Для доказательства синтеза в растениях белковых продуктов бирепортерного гена, белковые лизаты, полученных из листьев растений табака после агроинфильтрации, проанализированы методом энзимограмм (рис. 9).

Рисунок 9. Пример энзимограмм на активность лихеназы в белковых лизатах, полученных из листьев растений табака Nicotiana benthamiana через 4 дня после агроинфильтрации. 1, 2 и 3 – белковые лизаты растений после агроинфильтрации векторами 35S-LicB, 35S-G-L и 35S-LeB4-G-L-KDEL.

Как видно из результатов, представленных на рисунке 8, в листьях растений табака Nicotiana benthamiana происходит образование белкового продукта бирепортерного гена.

Для сравнительного анализа эффективности тестируемых регуляторных элементов был определен уровень накопления бирепортерного белка в листьях растений табака Nicotiana benthamiana при агроинфильтрации. Оценку уровня накопления рассчитывали по активности лихеназы, как части бирепортерного белка, в перерасчете на суммарный растворимый белок.

На рисунке 10 представлены суммируемые результаты тестирования эффективности регуляторных элементов.

Рисунок 10.

Сравнительный анализ эффективности регуляторных элементов, тестированных в растениях табака Nicotiana benthamiana при агроинфильтрации

Как видно из результатов, представленных на рисунке 10, все тестированные регуляторные элементы обеспечивают более высокий уровень накопления белкового продукта бирепортерного гена в растительных клетках по сравнению с контролем. При этом уровень накопления белкового продукта бирепортерного гена при использовании лидерного сигнала, обеспечивающего транспорт и удержание белкового продукта в эндоплазматическом ретикулуме (35S-LeB4-G-L-KDEL), превышает такой контроля (35S-G-L) приблизительно в 2,5 раз, при использовании лидерных сигналов для локализации в хлоропласты (35S-lch-G-L) и межклеточном пространстве растительных клеток (35S-lex-G-L) – на 0,2 и 0,5 раза. При тестировании 5’-нетранслируемых GC-богатых областей разной доины и композиции (35S-S1-G-L (размер 405 п.н., GC-содержание 62,0) и 35S-S1-G-L (размер 2025 п.н., GC-содержание 62,5) в отношении их эффективности обеспечивать высокоэффективную экспрессию, и, как следствие, накопление белкового продукта показано, что эти регуляторные последовательности обеспечивают высокий уровень накопления белкового продукта бирепортерного гена, который в 2,5 и 3,5 раза, превышает таковой для контроля.

Таким образом, проведенное тестирование регуляторных элементов с использованием репортерных систем позволило сделать следующее заключение: в растениях после агроинфильтрации происходит образование гибридного белкового продукта бирепортерного гена, в составе которого зеленый флуоресцентный белок и термостабильная лихеназа сохраняют свои основные свойства; выбранные регуляторные элементы обеспечивают более высокий уровень накопления белкового продукта в растениях, по сравнению с растениями после агроинфильтрации вектором, не несущим дополнительных регуляторных элементов; определен рейтинг апробированных регуляторных элементов в отношении обеспечения уровня накопления белкового продукта бирепортерного гена: 35S-S2-G-L —— > 35S-S1-G-L —— >35S-LeB4-G-L-KDEL —— > 35S-S1-G-L —— > 35S-Lex-G-L —— > 35S-Lch-G-L.

3.4. Анализ последовательностей модельных и целевых генов и модификация их кодонового состава

Для анализа нуклеотидных последовательностей рекомбинантных белков-носителей, а также модельных и целевых белков с было разработанно программное обеспечение базы данных FlowPlantGene, которое позволяет оценить необходимость модификации последовательности гетерологичного гена для увеличения эффективности его экспрессии в растениях.

Первоначально, мы протестировали программное обеспечение базы данных FlowPlantGene с использованием нуклеотидной последовательности красного флуоресцентного белка (RFP), которая имеет оптимальный кодоновый состав для экспрессии в эукариотах, в целом, и в растениях, в частности (ЗАО «Евроген», Россия). В качестве контроля использовали нуклеотидную последовательность этого же белка, размещенную в NCBI ( HYPERLINK «http://www.ncbi.nlm.nih.gov/nuccore/EF606900.1» http://www.ncbi.nlm.nih.gov/nuccore/EF606900.1) до модификации. Результаты проведенного анализа представлены на рисунке 11.

А

ATG GTG AGT AAA GGT GAA GAG TTG ATT AAA GAG AAC ATG CAT ATG AAG TTA TAC ATG GAG GGA ACT GTC AAT AAT CAC CAC TTT AAG TGT ACA TCA GAG GGT GAG GGA AAG CCA TAC GAG GGA ACC CAA ACT ATG AGA ATC AAA GTA GTG GAG GGA GGT CCT CTT CCA TTT GCT TTT GAT ATA CTA GCA ACA AGT TTC ATG TAT GGT TCC AGG ACC TTC ATT AAC CAT ACT CAG GGA ATC CCT GAC TTC TTT AAA CAG TCT TTT CCT GAA GGT TTT ACA TGG GAG AGG GTT ACC ACT TAC GAG GAC GGT GGA GTC TTG ACA GCA ACC CAG GAC ACT TCA TTA CAA GAT GGA TGC CTA ATA TAC AAT GTG AAA ATT AGG GGT GTG AAT TTC CCT AGT AAC GGA CCA GTT ATG CAG AAG AAA ACA CTA GGT TGG GAA GCT AAT ACT GAA ATG TTG TAC CCT GCC GAC GGA GGT TTA GAA GGT AGA TCC GAC ATG GCC CTT AAG CTA GTC GGA GGT GGA CAC TTG ATC TGT AAC TTT AAA ACC ACA TAT AGG TCT AAG AAG CCA GCA AAG AAT CTA AAA ATG CCT GGT GTT TAC TAT GTG GAC CAT AGA CTA GAA AGG ATA AAA GAA GCA GAC AAA GAA ACT TAC GTG GAG CAA CAT GAG GTC GCC GTC GCT AGG TAT TGC GAC TTA CCT TCC AAG CTA GGT CAC AAA TTG AAC

Б

ATG AGC GAG CTG ATT AAG GAG AAC ATG CAC ATG AAG CTG TAC ATG GAG GGC ACC GTG AAC AAC CAC CAC TTC AAG TGC ACA TCC GAG GGC GAA GGC AAG CCC TAC GAG GGC ACC CAG ACC ATG AGA ATC AAG GTG GTC GAG GGC GGC CCT CTC CCC TTC GCC TTC GAC ATC CTG GCT ACC AGC TTC ATG TAC GGC AGC AGA ACC TTC ATC AAC CAC ACC CAG GGC ATC CCC GAC TTC TTT AAG CAG TCC TTC CCT GAG GGC TTC ACA TGG GAG AGA GTC ACC ACA TAC GAA GAC GGG GGC GTG CTG ACC GCT ACC CAG GAC ACC AGC CTC CAG GAC GGC TGC CTC ATC TAC AAC GTC AAG ATC AGA GGG GTG AAC TTC CCA TCC AAC GGC CCT GTG ATG CAG AAG AAA ACA CTC GGC TGG GAG GCC AAC ACC GAG ATG CTG TAC CCC GCT GAC GGC GGC CTG GAA GGC AGA AGC GAC ATG GCC CTG AAG CTC GTG GGC GGG GGC CAC CTG ATC TGC AAC TTC AAG ACC ACA TAC AGA TCC AAG AAA CCC GCT AAG AAC CTC AAG ATG CCC GGC GTC TAC TAT GTG GAC CAC AGA CTG GAA AGA ATC AAG GAG GCC GAC AAA GAG ACC TAC GTC GAG CAG CAC GAG GTG GCT GTG GCC AGA TAC TGC GAC CTC CCT AGC AAA CTG GGG CAC AAG TGA

Рисунок 11. Нуклеотидные последовательности модифицированного RFP (А) и нативного RFP (Б) и результаты сравнительного анализа нуклеотидной последовательности модифицированного (А) и нативного (Б) гена RFP по кодоновому составу в сравнении с кодоновым составом генов растений. Синие столбцы – средние значения кодонового состава генов растений, красные столбцы – кодоновый состав гена RFP.

Как видно из представленных данных нуклеотидная последовательность модифицированного варианта RFP не содержит редких для растений кодонов, в отличие от последовательности нативного RFP, для которого характерны значительные отличия в кодоновом составе по сравнению с таковым растений. Выравнивание нуклеотидных последовательностей модифицированного и нативного RFP показало, что в последовательности модифицированного варианта RFP произведены значительные замены одних нуклеотидов на другие (рис. 12).

gw_tagrfp ATGGTGAGTAAAGGTGAAGAGTTGATTAAAGAGAACATGCATATGAAGTTATACATGGAG 60

ncbitagrfp —ATGAGC———GAGCTGATTAAGGAGAACATGCACATGAAGCTGTACATGGAG 48

**** *** ******* *********** ****** * *********

gw_tagrfp GGAACTGTCAATAATCACCACTTTAAGTGTACATCAGAGGGTGAGGGAAAGCCATACGAG 120

ncbitagrfp GGCACCGTGAACAACCACCACTTCAAGTGCACATCCGAGGGCGAAGGCAAGCCCTACGAG 108

** ** ** ** ** ******** ***** ***** ***** ** ** ***** ******

gw_tagrfp GGAACCCAAACTATGAGAATCAAAGTAGTGGAGGGAGGTCCTCTTCCATTTGCTTTTGAT 180

ncbitagrfp GGCACCCAGACCATGAGAATCAAGGTGGTCGAGGGCGGCCCTCTCCCCTTCGCCTTCGAC 168

** ***** ** *********** ** ** ***** ** ***** ** ** ** ** **

gw_tagrfp ATACTAGCAACAAGTTTCATGTATGGTTCCAGGACCTTCATTAACCATACTCAGGGAATC 240

ncbitagrfp ATCCTGGCTACCAGCTTCATGTACGGCAGCAGAACCTTCATCAACCACACCCAGGGCATC 228

** ** ** ** ** ******** ** *** ******** ***** ** ***** ***

gw_tagrfp CCTGACTTCTTTAAACAGTCTTTTCCTGAAGGTTTTACATGGGAGAGGGTTACCACTTAC 300

ncbitagrfp CCCGACTTCTTTAAGCAGTCCTTCCCTGAGGGCTTCACATGGGAGAGAGTCACCACATAC 288

** *********** ***** ** ***** ** ** *********** ** ***** ***

gw_tagrfp GAGGACGGTGGAGTCTTGACAGCAACCCAGGACACTTCATTACAAGATGGATGCCTAATA 360

ncbitagrfp GAAGACGGGGGCGTGCTGACCGCTACCCAGGACACCAGCCTCCAGGACGGCTGCCTCATC 348

** ***** ** ** **** ** *********** * ** ** ** ***** **

gw_tagrfp TACAATGTGAAAATTAGGGGTGTGAATTTCCCTAGTAACGGACCAGTTATGCAGAAGAAA 420

ncbitagrfp TACAACGTCAAGATCAGAGGGGTGAACTTCCCATCCAACGGCCCTGTGATGCAGAAGAAA 408

***** ** ** ** ** ** ***** ***** ***** ** ** ************

gw_tagrfp ACACTAGGTTGGGAAGCTAATACTGAAATGTTGTACCCTGCCGACGGAGGTTTAGAAGGT 480

ncbitagrfp ACACTCGGCTGGGAGGCCAACACCGAGATGCTGTACCCCGCTGACGGCGGCCTGGAAGGC 468

***** ** ***** ** ** ** ** *** ******* ** ***** ** * *****

gw_tagrfp AGATCCGACATGGCCCTTAAGCTAGTCGGAGGTGGACACTTGATCTGTAACTTTAAAACC 540

ncbitagrfp AGAAGCGACATGGCCCTGAAGCTCGTGGGCGGGGGCCACCTGATCTGCAACTTCAAGACC 528

*** ************ ***** ** ** ** ** *** ******* ***** ** ***

gw_tagrfp ACATATAGGTCTAAGAAGCCAGCAAAGAATCTAAAAATGCCTGGTGTTTACTATGTGGAC 600

ncbitagrfp ACATACAGATCCAAGAAACCCGCTAAGAACCTCAAGATGCCCGGCGTCTACTATGTGGAC 588

***** ** ** ***** ** ** ***** ** ** ***** ** ** ************

gw_tagrfp CATAGACTAGAAAGGATAAAAGAAGCAGACAAAGAAACTTACGTGGAGCAACATGAGGTC 660

ncbitagrfp CACAGACTGGAAAGAATCAAGGAGGCCGACAAAGAGACCTACGTCGAGCAGCACGAGGTG 648

** ***** ***** ** ** ** ** ******** ** ***** ***** ** *****

gw_tagrfp GCCGTCGCTAGGTATTGCGACTTACCTTCCAAGCTAGGTCACAAATTGAAC 711

ncbitagrfp GCTGTGGCCAGATACTGCGACCTCCCTAGCAAACTGGGGCACAAGT-GA— 696

** ** ** ** ** ****** * *** *** ** ** ***** * **

Рисунок 12. Результат выравнивания нуклеотидных последовательностей модифицированного и нативного RFP в программе ClustalW, где gw_tagrfp – последовательность модифицированного варианта RFP, ncbitagrfp – последовательность нативного RFP.

Ранее было продемонстрировано, что модифицированный RFP эффективно экспрессируется в растительных клетка. Полученные данные позволяют предположить надежность результатов анализа с использованием программного обеспечения базы данных FlowPlantGene.

Аналогичным образом были проанализированы последовательности нативных вариантов генов, кодирующих интерферон-альфа-А2, циклически перестановленную термостабильную лихеназу и зеленый флуоресцентный белок, а также были оптимизированы соответствующие гены по кодоновому составу.

Далее методом ферментативного синтеза были сконструированы целевые модельные гены с оптимизированным кодоновым составом.

3.5. Создание модульных векторов, несущих модельные и целевые гены с модификациями кодонового состава и без модификации

Для экспериментальной проверки роли соответствия кодонового состава генов для их эффективной экспрессии в растениях, были сконструированы модульные вектора, несущие модельные и целевые гены с модификациями кодонового состава и без таковой: оптимизированный и неоптимизированный по кодоновому составу ген, кодирующий интерферон-альфа-А2 и оптимизированный и неоптимизированный по кодоновому составу ген, кодирующий термостабильную лихеназу.

Поскольку интерферон не обладают ферментативными активностями, за счет которых можно проводить простую оценку их накопления в растениях, нами сконструированы гибридный ген, в котором неоптимизированный целевой ген, а также этот ген с оптимизированным кодоновым составом, имеет транскрипционно-трансляционное слияние с последовательностью гена, кодирующего термостабильную лихеназу.

Полученные оптимизированные и неоптимизированные последовательности модельного (inf-A2::licBM3) и целевого (licBM3-CP) генов затем были клонированы в модульные вектора pPGG и pVIG-S с помощью методов молекулярного клонирования (рис. 13).

Рисунок 13. Серия модульных векторов на основе вектора pVIG-S для стабильной экспрессии трансгена.

3.6. Сравнительный анализ экспрессии модельных и целевых генов с оптимизированным и неоптимизированным кодоновым составом в растениях табака

Для того чтобы экспериментально проверить насколько кодоновый состав гетерологичных генов влияет на эффективность их экспрессии была проведена агробактериальная инфильтрация растений табака разных родов N. benthamiana и N. excelsior.

Для удобства интерпретации и восприятия полученных результатов линий растений N. benthamiana, трансфецированных сконструированными векторами, были обозначены нами следующим образом: B-IN-Lic (вектор pVIG-S-5A); B-INop-LicB (вектор pVIG-S-5B); B-CP (вектор pVIG-S-7A) и B-CPop (вектор pVIG-S-7B), а для линии растений N. excelsior — E-IN-Lic (вектор pVIG-S-5A); E-INop-LicB (вектор pVIG-S-5B); E-CP (вектор pVIG-S-7A) и E-CPop (вектор pVIG-S-7B).

Полученными экспрессионными векторами проведена трансформация агробактериального штамма GV3101 и далее полученными агробактериальными трансформантами проведена агроинфильтрация растения Nicotiana benthamiana и N. excelsior.

Для доказательства синтеза в растениях белковых продуктов гетерологичных генов, белковые лизаты, полученных из листьев растений табака после агроинфильтрации, проанализированы методом энзимограмм (рис. 14).

Рисунок 14. Пример энзимограммы на активность лихеназы в белковых лизатах, полученных из листьев растений табака Nicotiana benthamiana и N. excelsior через 4 дня после агроинфильтрации. 1, 2, 3, 4 – белковые лизаты растений после агроинфильтрации векторами E-CP, B-IN-Lic, B-INop-LicB и E-INop-LicB; М – маркер молекулярных масс.

Как видно из результатов, представленных на рисунке 14, при экспрессии гетерологичных генов в листьях растений табака Nicotiana benthamiana и N. excelsior, происходит образование белков, молекулярная масса которых соответствует теоретически рассчитанной – 25 кДа (для лихеназы — E-CP) и 49 кДа (для интерферона-альфа-2А — B-IN-Lic, B-INop-LicB и E-INop-LicB).

Для сравнительного анализа эффективности тестируемых регуляторных элементов был определен уровень накопления бирепортерного белка в листьях растений табака Nicotiana benthamiana и N. excelsior при агроинфильтрации. Оценку уровня накопления рассчитывали по активности лихеназы, как части бирепортерного белка, в перерасчете на суммарный растворимый белок.

На рисунках 15 и 16 представлены суммируемые результаты тестирования экспрессии гетерологичных генов с оптимизированным и неоптимизированным кодоновым составом в различных видах растений табака.

Рисунок 15. Сравнительный анализ эффективности экспрессии гетерологичных генов с разным кодоновым составом в растениях табака Nicotiana benthamiana при агроинфильтрации.

Рисунок 16. Сравнительный анализ эффективности экспрессии гетерологичных генов с разным кодоновым составом в растениях табака Nicotiana excelsior при агроинфильтрации.

Как видно из результатов, представленных на рисунках 15 и 16, при экспрессии в растениях табака гетерологичных генов с оптимизированным кодоновым составом отмечается достоверное увеличение уровня накопления соответствующего белкового продукта в растительных клетках по сравнению с накоплением белкового продукта гетерологичного гена с неоптимизированным для экспрессии в растениях кодоновым составом.

Таким образом, сравнительное тестирование экспрессии гетерологичных генов с оптимизированным кодоновым составом и без оптимизации в растениях табака разных видов позволило сделать следующее заключение: в растениях табака после агроинфильтрации происходит образование белковых продуктов гетерологичных генов; отмечается достоверное увеличение уровня накопления белковых продуктов исследованных гетерологичных генов с оптимизированным для эффективной экспрессии кодоновым составом по сравнению с гетерологичными генами без оптимизации кодонового состава; отмечена сходная зависимость увеличения уровня накопления белковых продуктов исследованных гетерологичных генов с оптимизированным для эффективной экспрессии кодоновым составом для растений табака двух разных видов.



Страницы: 1 | 2 | Весь текст